SciELO - Scientific Electronic Library Online

 
vol.68 número4Efecto del extracto hidroalcohólico liofilizado de hojas de Bixa orellana (achiote), en la secreción gástrica de ratasMarcadores de estrés oxidativo en placentas de gestantes añosas índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Articulo

Indicadores

  • No hay articulos citadosCitado por SciELO

Links relacionados

  • No hay articulos similaresSimilares en SciELO

Bookmark


Anales de la Facultad de Medicina

versión impresa ISSN 1025-5583

An. Fac. med. v.68 n.4 Lima dic. 2007

 

TRABAJOS ORIGINALES

 

Polimorfismo Val108/158Met en el gen dopaminérgico catecol-o-metil transferasa (COMT) en una población mixta peruana y su importancia para los estudios neuropsiquiátricos

Val108/158Met polymorphism in the catechol-o-methyl transferase (COMT) dopaminergic gene in mestizo Peruvian population and its importance in neuropsychiatric studies

 

Doris Huerta 1, Oscar Acosta 1, Susan Polo 1, Rolando Martinez 1, Raquel Oré 1, Cecilia Miranda 2

1 Centro de Investigación de Bioquímica y Nutrición. Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Perú.
2 Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Lima, Perú.

 


 

Resumen

Introducción: El gen dopaminérgico catecol-o-metil transferasa (COMT), tiene un polimorfismo funcional Val108/158Met que da lugar a variantes de la enzima que cataliza la o-metilación de las catecolaminas activas, participando en el metabolismo de las drogas y neurotransmisores, como la L-dopa, norepinefrina, epinefrina y dopamina y, por consiguiente, puede asociarse a condiciones neuropsiquiátricas. Objetivos: Determinar las frecuencias genotípicas y alélicas del polimorfismo Val108/158Met del gen COMT en sujetos saludables de una población mixta peruana y establecer las implicancias para el estudio genético de enfermedades y otras condiciones neuropsiquiátricas. Diseño: Estudio descriptivo, observacional, transversal. Lugar: Centro de Investigación de Bioquímica y Nutrición ‘Alberto Guzmán Barrón’. Facultad de Medicina, Universidad Nacional Mayor de San Marcos. Participantes: Ciento seis personas, hombres y mujeres, clínicamente saludables, sin enfermedades neurológicas ni mentales u otra patología similar, voluntarios con consentimiento informado, sin relación de parentesco, todos residentes en Lima, cuyas edades fluctuaban entre los 18 y 50 años. Intervenciones: Extracción del ADN genómico a partir de células de epitelio bucal, según metodología estándar. Amplificación mediante la PCR con primers específicos y digestión con la enzima de restricción NlaIII. Detección de fragmentos de restricción de longitud polimórfica (RFLP) por electroforesis en gel de poliacrilamida al 6%, teñido con nitrato de plata. Principales medidas de resultados: Frecuencias genotípicas y alélicas del gen COMT en población mixta peruana. Resultados: Se encontró las frecuencias genotípicas Met/Met=0,0661, Val/Met=0,5094 y Val/Val=0,4245, siendo la distribución consistente con el equilibrio de Hardy-Weinberg (X2 =3,0317, g.l.=1, p >0,05). Las frecuencias alélicas encontradas fueron alelo Val=0,68 y el alelo Met=0,32. Conclusiones: El genotipo heterocigoto Val/Met y el alelo Val del gen dopaminérgico COMT son los más frecuentes en esta población mixta estudiada. Este polimorfismo Val108/158Met, en interacción gen-gen y gen-medioambiente, debe ser considerado en los estudios de genética neuropsiquiátrica, tanto en poblaciones mixtas como en nativas.

Palabras clave: Catecol o-metiltransferasa; polimorfismo genético; alelos; neurología; psiquiatría.

 


 

Abstract

Introduction: Dopaminergic catechol-o-methyl transferase (COMT) gene has a functional polymorphism Val108/158Met that originates enzyme variants that catalyze o-methylation of active catecholamines and participates in drugs and neurotransmitters metabolism including L-dopa, norepinephrine, epinephrine and dopamine and thus may be associated to neuropsychiatric conditions. Objectives: To determine COMT gene genotypes and alleles frequencies in mestizo Peruvian population healthy subjects and its importance in neuropsychiatric genetic studies. Design: Descriptive, observational, transversal study. Setting: Alberto Guzman Barron Biochemistry and Nutrition Research Center, Faculty of Medicine, Universidad Nacional Mayor de San Marcos. Participants: One hundred and six healthy subjects, male and female volunteers with informed consent, without family relationship or mental and neurological disorders as determined by clinical assessment, all Lima residents, aged between 18 and 50 years. Interventions: Genomic DNA was extracted from buccal epithelium cells to 106 individuals seemingly healthy, previous informed consent, using standard methodology. We typed using polymerase chain reaction (PCR) of the relevant region followed by digestion with N1aIII enzyme and polyacrilamyde gel electrophoresis and silver nitrate stain. Main outcomes measures: COMT gene genotypes and alleles frequencies in mixed Peruvian population. Results: We found frequencies Met/Met genotype=0,0661, Val/Met genotype=0,5094, and Val/Val genotype=0,4245, distribution consistent with Hardy-Weinberg expectations (X2 = 3,0317, g.l.=1, p >0,05). Alleles frequencies were Val allele=0,679 and Met allele=0,321. Conclusions: Val/Met heterozygote and Val allele were significantly more common in the mixed Peruvian population. In gene-gene interaction and gene-environment Val108/158Met polymorphism must be considered in neuropsychiatric genetic studies in both mixed and native populations.

Key words: Catechol o-methyltransferase; polymorphism, genetic; alleles; neurology; psychiatry.

 


 

INTRODUCCIÓN

Las enfermedades neuropsiquiátricas representan un problema de salud en el mundo moderno. El Perú no es ajeno a esta problemática mundial y esto se hace más complejo, porque nuestro país no desarrolla una adecuada política de salud neurológica y mental. Una estrategia para enfrentar las enfermedades en general y, en particular, las neurológicas y mentales, es estudiando el aspecto genético molecular a nivel individual y poblacional. Actualmente, uno de los genes más estudiados en enfermedades neurológicas y mentales es el de la catecol-o-metil transferasa (COMT), gen dopaminérgico que tiene un polimorfismo funcional que da lugar a variantes de la enzima, que cataliza la o-metilación de las catecolaminas biológicamente activas y es el mayor componente del metabolismo de las drogas y neurotransmisores, tales como la L-dopa, dopamina, norepinefrina y epinefrina, siendo mayor su actividad en la corteza frontal ( 1 ).

La enzima catecol-o-metil transferasa (COMT, EC 2.1.1.6) cataliza la transferencia de un grupo metilo de la coenzima S-adenosil-metionima (SAM) a uno de los grupos hidroxilo de las catecolaminas, en presencia de magnesio, para degradarlas. Es la principal enzima de los mamíferos involucrada en la degradación metabólica de la dopamina liberada (más de 60% de la degradación metabólica de la dopamina en la corteza frontal) ( 1 ).

La enzima es codificada por el gen COMT, en el cromosoma 22, tiene dos alelos polimórficos (Val=Valina o H=High o G=Guanina, y Met=Metionina o L=Low o A=Adenina) y da lugar a 3 genotipos: Val/Val (HH=actividad enzimática alta), Val/Met (HL=actividad enzimática media) y Met/Met (LL=actividad enzimática baja). Los polimorfismos del gen COMT determinan la actividad de la enzima COMT y la capacidad de degradar o inactivar las catecolaminas. Por ello, factores genéticos que afecten la función de COMT podrían también afectar la función dopaminérgica ( 1,2 ).

En detalle, este gen contiene una mutación -reciente en términos evolutivos- en la que una guanina (G) es reemplazada por una adenina (A) y que en la proteína se manifiesta por la presencia de una metionina (Met) en vez de una valina (Val), en el codón 108 (forma soluble de la COMT) o el codón 158 (forma unida a la membrana de la COMT); por eso, la denominación Val108/158Met. La enzima que contiene metionina es inestable a 37° C y su actividad es 4 veces menor con respecto a la enzima que contiene valina. Los alelos Met y Val son codominantes y los individuos heterocigotos tienen una actividad enzimática que es intermedia con respecto a los individuos homocigotos. La alta actividad relacionada con el alelo Val produce un mayor catabolismo de la dopamina y en contraparte el alelo Met se relaciona con un menor catabolismo, lo cual puede estar asociado con diferentes condiciones y características neuropsiquiátricas ( 1-3 ).

Este polimorfismo funcional del gen, por otro lado, se ha demostrado es variable en las distintas poblaciones humanas, y su estudio en relación a enfermedades neurológicas, mentales y características complejas en poblaciones saludables está relacionado con las diferencias en las frecuencias alélicas y genotípicas de los diferentes grupos raciales, como por ejemplo algunas poblaciones africanas, donde se ha demostrado que el alelo de baja actividad -alelo Met- es menos común, o en poblaciones turcas, que son las mismas que las poblaciones caucásicas, pero diferentes a las orientales ( 4-6 ).

Las enfermedades neurológicas que están relacionadas con actividad dopaminérgica y, por tanto, al gen COMT y a las enzimas que metilan catecolaminas, son los trastornos de Alzheimer, Huntington y Parkinson, las cuales han sido estudiadas en poblaciones europeas, asiáticas y norteamericanas ( 7-11 ).

En enfermedades mentales, como la esquizofrenia, se ha establecido asociación del gen COMT y sus variantes enzimáticas con ciertos endofenotipos de la función cognitiva y memoria, principalmente con los genotipos que tienen el alelo Val. También, está involucrado en la respuesta diferencial a los fármacos utilizados en esta enfermedad ( 12-15 ). También, este polimorfismo ha sido asociado a otras patologías, como alcoholismo, conducta agresiva, problemas de aprendizaje, la respuesta diferencial a los neurofármacos, estrés, psicosis, adicción, sensibilidad al dolor, entre otras, y ciertas características neuropsicológicas en sujetos saludables ( 13,16-19 ).

La importancia en neuropsiquiatría de este polimorfismo radica en su influencia en el sistema dopaminérgico, pero no necesariamente como un factor genético único, sino en su interacción con otros neurogenes y con factores medioambientales ( 20 ).

Los estudios señalan, de manera directa o indirecta, que el polimorfismo en el gen COMT puede estar asociado, en interacción con otros genes y factores ambientales, con el riesgo para ciertos estados neuropsiquiátricos (condiciones clínicas o endofenotipos), además de estar involucrados con características neuropsicológicas en personas saludables. Es de interés conocer cuál es la distribución de este polimorfismo genético dopaminérgico en la población peruana, empezando por la población general. Nuestra población, caracterizada por su diversidad y mestizaje, debe ser estudiada bajo el enfoque moderno de la genética molecular. Este primer estudio representa una etapa previa para establecer asociaciones de condiciones neuropsiquiátricas con marcadores genéticos moleculares.

MÉTODOS

Se realizó un estudio descriptivo, observacional, transversal. Los participantes en la investigación fueron 106 personas (40% hombres y 60% mujeres), clínicamente sanos, voluntarios, sin relación de parentesco, saludables, sin enfermedades neurológicas ni mentales u otra patología similar, determinados por apreciación clínica, todos residentes en Lima, cuyas edades fluctuaban entre los 18 y 50 años.

Los participantes firmaron el consentimiento informado, que incluye la finalidad de la investigación, condiciones, procedimiento, riesgos y beneficios, confidencialidad de los resultados y datos de los investigadores.

Para el estudio se extrajo el ADN genómico a partir de células del epitelio bucal (hisopado bucal), siguiendo el procedimiento estándar reportado por Martinez ( 21 ), las cuales fueron lisadas en buffer y tratadas con proteinasa K (10 mg/ml), a 56° C, por 24 horas. Se determinó los genotipos de la enzima COMT con la técnica RFLP (digestión con enzima NlaIII), después de amplificación por PCR con primers específicos (Comt 1: 5’ CTCATCACCATCGAGATCAA 3´ y Comt 2: 5´ CCAGGTCTGACAACGGGTCA 3’), según lo informado por Egan ( 12 ), Malhotra ( 13 ) y Lachman ( 17 ) y estandarizada de acuerdo a las condiciones del laboratorio de Biología Molecular, CIBN, Facultad de Medicina, UNMSM. Se empleó 5 ng/mL de ADN, 2,5 mM dNTP, 25 mM Cl2Mg y las siguientes condiciones: 38 ciclos, 3 min, desnaturalización inicial a 94° C; 12” a 94°C, 25” a 60°C, 30” a 72°C, para la fase de extensión inicial, seguido de 5 min, a 72°C, para la extensión final.

Se obtuvo un amplificado de 109 pares de bases (pb) y la restricción generó bandas de 86/23 pb (homocigotos Val/Val), bandas de 68/18 pb (homocigotos Met/Met) y bandas de 86/68/23/18 pb (heterocigotos Val/Met), visualizados -solo las bandas 86 y 68pb- por tinción con nitrato de plata, previa electroforesis en gel de poliacrilamida al 6% (Figura 1). Finalmente, se calculó los porcentajes, frecuencias genotípicas y alélicas, utilizando el paquete estadístico SPSS y Programas para Genética Poblacional.

 

 

RESULTADOS

En la muestra de 106 personas evaluadas, se encontró 7 con genotipo Met/Met (frecuencia genotípica Met/Met=0,07), 54 con genotipo Val/Met (frecuencia genotípica Met/Val=0,51) y 45 con genotipo Val/Val (frecuencia genotípica Val/Val=0,42), siendo la distribución consistente con el equilibrio de Hardy-Weinberg (X2 = 3,0317, g.l.=1, p > 0,05). Las frecuencias alélicas encontradas fueron: alelo Val=0,68 y el alelo Met=0,32. Los resultados son mostrados en la Tabla 1 ( 22,23 ).

 

 

Los resultados nos indican una relativa predominancia de individuos heterocigotos Met/Val sobre los homocigotos Val/Val y de ambos, en gran medida, sobre los homocigotos Met/Met. El alelo Val es predominante en esta poblacion mixta (mestiza) peruana.

DISCUSIÓN

En el Perú, por su diversidad genética poblacional y por la incidencia y prevalencia de enfermedades neurológicas y mentales, es importante estudiar genes con polimorfismos funcionales que permitan asociarlos a la predisposición a enfermedades, pues de esa manera se podrá tratarlas adecuadamente en un contexto integral que incluya el aspecto genético. Este enfoque es adoptado por países que, como el Perú, se caracterizan por su mixtura, mestizaje o miscigenación ( 24 ).

Las frecuencias genotípicas y/o alélicas del gen dopaminérgico COMT, encontradas en esta muestra mixta peruana, son cercanas a las señaladas para algunas poblaciones africanas (Kenia, Ghana), asiáticas (taiwaneses y japoneses), nativos norteamericanos (Cheyenne), sudamericanos (Rondonian surui), y de Oceanía (melanesios). Difieren principalmente de las informadas para el alelo Met en poblaciones colombianas, chinas, asiáticos del suroeste, caucásicas (EE UU, Finlandia y Gran Bretaña), judíos Ashkenazi, españoles, rusos y otros nativos norteamericanos (maya Yucatán, pima Arizona), sudamericanos (Ticuna y Karitiana) y de Oceanía, los micronesios (Tabla 1 y Figura 2).

 

 

Como se aprecia, existen similitudes y diferencias genotípicas y/o alélicas entre la población mixta peruana estudiada y las poblaciones de diferentes partes del mundo, lo cual puede tener implicancias en la prevalencia e incidencia en diversos trastornos neuropsiquiátricos ( 15,19 ). Sin embargo, su efecto no sería por su influencia únicamente, sino porque interacciona con otros neurogenes y estresores o factores ambientales ( 20 ).

La población actual de Lima se caracteriza por su mixtura (mestizaje o miscigenación), debido a la mezcla del componente étnico amerindio o indígena (nativo), caucásico, asiático y/o africano. La migración hacia la capital de diferentes grupos provenientes de la costa, sierra y selva de nuestro país y en menor grado de otros países, es un factor asociado a este mestizaje. Es posible que en otras regiones del Perú, donde la influencia étnica amerindia es mayor, las frecuencias de los alelos Val y Met del gen COMT estudiado pueda ser distinta y, por consiguiente, tener otras implicancias en la genética neuropsiquiátrica, por ser este gen y las variantes enzimáticas que codifica muy importantes en el sistema dopaminérgico, especialmente de la corteza frontal ( 4,15,19 ).

La predominancia del alelo Val y del genotipo heterocigoto Val/Met encontrada en esta muestra nos da un indicador o referencia de la distribución de este polimorfismo del gen COMT. Sin embargo, su asociación con características clínicas o endofenotipos, interactuando con otros genes y factores ambientales, en enfermedades o estados como el Parkinson, esquizofrenia, psicosis, estrés, hiperactividad, depresión, alcoholismo, adicción a las drogas, respuesta diferencial a fármacos, sensibilidad al dolor, etc. y ciertas características cognitivas y neuropsicológicas en personas saludables, tal como se estudia en otras poblaciones ( 8,9,12-14,16,18,20 ), son investigaciones pendientes en las subpoblaciones peruanas, tanto mixtas como nativas.

Es necesario, por consiguiente, estudiar en forma general las frecuencias alélicas de los diferentes genes en nuestras subpoblaciones, ya que, como sucede con el gen COMT ( 4,22,23 ), se demuestra variaciones en diferentes poblaciones del mundo. La variabilidad dentro de nuestra población puede sesgar los resultados de los estudios genéticos de asociación (casos control, cohorte) con enfermedades, especialmente en poblaciones mixtas, como la peruana. Por eso, para evitar esta situación, es importante caracterizar las distintas subpoblaciones peruanas (mixtas así como nativas) utilizando métodos genético moleculares.

Concluimos que el genotipo heterocigoto Val/Met y el alelo Val del gen dopaminérgico COMT son los más frecuentes en la población mixta peruana estudiada, dándonos un indicador o referencia de la distribución de este polimorfismo, por lo que, en interacción con otros neurogenes y factores medioambientales, debe ser considerado en los estudios de genética neuropsiquiátrica, tanto en subpoblaciones mixtas como en nativas.

AGRADECIMIENTOS

Al Consejo Superior de Investigaciones de la Universidad Nacional Mayor de San Marcos, por la financiación del proyecto. A los Biólogos Raúl Tito y Alexandra Obregón, por su apoyo a la investigación.

REFERENCIAS BIBLIOGRÁFICAS

1. Mannisto P, Kaakkola S. Catechol-O-methyltransferase (COMT): biochemistry, molecular biology, pharmacology, and clinical efficacy of the new selective COMT inhibitors. Pharmacological Reviews. 1999;51(4):593-628.        [ Links ]

2. Braver T, Barch D, Cohen J. Cognition and control in schizophrenia: a computational model of dopamine and prefrontal function. Biol Psychiatry. 1999;46:312-28.        [ Links ]

3. Nokelainen P, Flint J. Genetic effects on human cognition: lessons from the study of mental retardation syndromes. J Neurol Neurosurg Psych. 2002;72:287-96.        [ Links ]

4. Palmatier M, Kang A, Kidd K. Global variation in the frequencies of functionally different catechol-O-methyltransferase alleles. Biol Psychiatry. 1999;46(4):557-67.        [ Links ]

5. Ameyaw M, Syvanen A, Ulmanen I, Ofori-Adjei D, McLeod H. Pharmacogenetics of catechol-O-methyltransferase: frequency of low activity allele in a Ghanaian population. Hum Mutat. 2000;16(5):445-6.        [ Links ]

6. Kocabas N, Karakaya A, Cholerton S, Sardas S. Catechol o-methyltransferase (COMT) genetic polymorphism in Turkish population. Arch Toxicol. 2001;75:407-9.        [ Links ]

7. Yoritaka A, Hattori N, Yoshino H, Mizuno Y. Catechol-O-methyltransferase genotype and susceptibility to Parkinson’s disease in Japan. Short communication. J Neural Transm. 1997;104(11-12):1313-7.        [ Links ]

8. Wu R, Cheng C, Chen K, Lu S, Shan D, Ho Y, et al. The COMT L allele modifies the association between MAOB polymorphism and PD in Taiwanese. Neurology. 2001;56(3):375-82.        [ Links ]

9. Watanabe M, Harada S, Nakamura T, Ohkoshi N, Yoshizawa K, Hayashi A, et al. Association between catechol-o-methyltransferase gene polymorphisms and wearing-off and dyskinesia in Parkinson’s disease. Neuropsychobiology. 2003;48:190-3.        [ Links ]

10. McGeer E, Kremer B, Hayden M. Monoamines and their metabolites in Huntington’s disease brain: Evidence for decreased catechol-O-methyltransferase activity. Biol Psychiatry. 1993;33:551-3.        [ Links ]

11. Kunugi H, Nanko S, Ueki A, Otsuka E, Hattori M, Hoda F, et al. High and low activity alleles of catechol-O-methyltransferase gene: ethnic difference and possible association with Parkinson’s disease. Neurosci Lett. 1997;221(2-3):202-4.        [ Links ]

12. Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub RE, et al. Effect of COMT Val-Met genotype on frontal lobe function and risk schizophrenia. Proc Natl Acad Sci U S A. 2001;98:6917-22.        [ Links ]

13. Malhotra A, Kestler L, Mazzanti C, Bates J, Goldberg T, Goldman D. A functional polymorphism in the COMT gene and performance on a test of prefrontal cognition. Am J Psychiatry. 2002;159:652-4.        [ Links ]

14. McLeod HL, Syvänen A, Githanga J, Indalo A, Ismail D, Dewar K, et al. Ethnic differences in catechol O-methyltransferase pharmacogenetics: Frequency of the codon 108/158 low activity allele is lower in Kenyan than Caucasian or South-west Asian individuals. Pharmacogenetics. 1998;8:195-9.        [ Links ]

15. Akil M, Kolachana B, Rothmond D, Hyde T, Weinberger D, Kleinman J. Catechol-O-methyltransferase genotype and dopamine regulation in the human brain. J Neuroscience. 2003;23(6):2008-13.        [ Links ]

16. Mattay V, Goldberg T, Fera F, Hariri A, Tessitore A, Egan M, et al. Catechol-o-methyltransferase val158-met genotype and individual variation in the brain response to amphetamine. PNAS. 2003;100:6186-91.        [ Links ]

17. Lachman H, Papolos D, Saito T, Yu Y, Szumlanski C, Weinshilboum R. Human catechol o-methyltransferase pharmacogenetics: Description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics. 1996;6:243-50.        [ Links ]

18. Zubieta J, Heitzeg M, Smith Y, Bueller J, Xu K, Xu Y, et al. COMT val158met genotype affects muopioid neurotransmitter responses to a pain stressor. Science. 2003;299:1240-3.        [ Links ]

19. Winterer G, Goldman D. Genetics of human prefrontal function. Brain Research Reviews. 2003;43(1):134-63.        [ Links ]

20. Van Winkel R, Henquet C, Rosa A, Papiol S, Fañanas L, De Hert M, et al. Polymorphism moderates sensivity to stress in Psychosis: An experience-sampling study. Am J Med Genet Part B. 2008;147B:10-7.        [ Links ]

21. Martinez R, Polo S, De La Cruz F, Tito R, Lizarraga B. Phenol free protocol for DNA isolation from human mouth swabs. Libro de Resúmenes de la XIII Reunión Científica ICBAR. Universidad Nacional Mayor de San Marcos. Lima, Perú. 2004. p. 66.        [ Links ]

22. DeMille M, Kidd J, Ruggeri V, Palmatier M, Goldman D, Odunsi A, et al. Population variation in linkage disequilibrium across the COMT gene considering promoter region and coding region variation. Human Genetics. 2002;111:521-37.        [ Links ]

23. Palmatier M, Pakstis A, Speed W, Paschou P, Goldman D, Odunsi A, et al. COMT haplotypes suggest P2 promoter region relevance for schizophrenia. Mol Psychiatry. 2004;9:859-70.        [ Links ]

24. Silva M, Cordeiro Q, Miracca E, Guindalini C, Vallada H. Distribución de alelos del polimorfismo VNTR en la región 3’ no codificante del gen del DAT1 (SLC6A3) en São Paulo/Brasil y su importancia para los estudios genéticos de los trastornos neuropsiquiátricos en poblaciones mixtas. Rev Méd Chile. 2005;133:1392-3.         [ Links ]

Manuscrito recibido el 17 de octubre de 2007 y aceptado para publicación el 13 de diciembre de 2007.

Correspondencia:
Mg. Doris Huerta Canales
Centro de Investigación de Bioquímica y Nutrición
Facultad de Medicina - UNMSM
Av. Grau 755. Lima 1, Perú
Correo-e: dorishuerta@yahoo.com